Regulatory sequence - PDFSEARCH.IO - Document Search Engine

Regulatory sequence
Results: 97

#	Item
31	of sequence introgression between N. vitripennis and N. longicornisThese results indicate that regulatory evolution of upd-like probably occurred in two separate Nasonia lineages, either by parallel reductions in Add to Reading List Source URL: www.condmat.physics.manchester.ac.uk Language: English - Date: 2013-02-19 07:04:39
32	Table S1: cis-regulatory elements identified in PpJAZ1 promoter sequence. Putative cis-element / consensus Putative function/response Add to Reading List Source URL: www.biomedcentral.com Language: English
33	B RIEFINGS IN BIOINF ORMATICS . VOL 12. NO^131 Advance Access published on 11 August 2010 doi:bib/bbq060 Evolution of gene regulationçon Add to Reading List Source URL: ibima.med.uni-rostock.de Language: English - Date: 2015-01-26 05:15:49 Promoter Regulatory sequence Evolutionary developmental biology Enhancer Transcription factor Sequence motif Cis-regulatory element Human genome Oct-4 Biology Gene expression Cis-regulatory module
34	Perspectives opinion Transposable elements and the evolution of regulatory networks Cédric Feschotte Add to Reading List Source URL: feschotte.genetics.utah.edu Language: English - Date: 2012-08-28 13:52:13 Molecular biology DNA RNA Transposable element Conserved non-coding sequence Noncoding DNA MicroRNA Promoter Insertion sequence Biology Genetics Gene expression
35	On schemes of combinatorial transcription logic Nicolas E. Buchler, Ulrich Gerland, and Terence Hwa* Department of Physics and Center for Theoretical Biological Physics, University of California at San Diego, La Jolla, C Add to Reading List Source URL: www.dna.caltech.edu Language: English - Date: 2015-02-12 02:54:55 RNA polymerase Promoter Transcription factor Lac operon Eukaryotic transcription Transcriptional regulation Transcription Gene regulatory network Regulatory sequence Biology Gene expression Biochemistry
36	Automatic detection of cis-regulatory binding regions Add to Reading List Source URL: icsb-2001.org Language: English - Date: 2001-12-04 14:14:41 Transcription factors DNA Genetics TRANSFAC Phylogenetic footprinting Cis-regulatory element Regulatory sequence Gene Cis-regulatory module Biology Gene expression Molecular biology
37	Integrated Clustering and Motif Detection For Genome−Wide Sequence and Expression Data Daniel N. Hill William S. Hlavacek Add to Reading List Source URL: icsb-2001.org Language: English - Date: 2001-12-04 14:14:40 DNA Genetics Microarrays Regulation of gene expression Gene Transcription factor Cluster analysis Cis-regulatory module Ridge Biology Gene expression Molecular biology
38	Table S2 The qPCR primers used for verification of the differentially expressed genes of the AA broiler hepatic tissues Gene name Primer sequence Product length（bp） β-actin forward: GAGAAATTGTGCGTGACATCA Add to Reading List Source URL: proteomesci.com Language: English Transcription factors SDHA Succinate dehydrogenase IRF3 Glutamate dehydrogenase 1 Interferon regulatory factors Glutamic acid Dehydrogenase CD36 Chemistry Biology Biochemistry
39	FamilyRelations: comparative sequence analysis of genomic data C. Titus Brown Tristan De Buysscher Add to Reading List Source URL: icsb-2001.org Language: English - Date: 2001-12-04 14:14:40 Bioinformatics DNA Phylogenetic footprinting Phylogenetics Noncoding DNA Sequence analysis Genomics Regulatory sequence Eric H. Davidson Biology Gene expression Genetics
40	Resurrection of DNA Function In Vivo from an Extinct Genome Andrew J. Pask1,2, Richard R. Behringer1, Marilyn B. Renfree2 1 Department of Molecular Genetics, University of Texas M. D. Anderson Cancer Center, Houston, Te Add to Reading List Source URL: www.petermaas.nl Language: English* - Date: 2011-02-06 05:02:44 Molecular biology Thylacine Enhancer Noncoding DNA Gene Regulatory sequence DNA Human genome Molecular cloning Biology Genetics Gene expression

UPDATE